Human Variations- Solar Radiation

High levels of solar radiation-

1. Normal exposure to ultraviolet radiation is important because it is necessary in the creation of vitamin D. Without vitamin D, our bodies are not as capable at absorbing calcium and phosphorus. Calcium is a necessary component for building bones, maintaining heart health, blood clotting, and used by the nervous system. Vitamin D is also helpful in fighting infections.

          However, when exposure to solar radiation is too extreme, the melanocytes in the epidermis responds by creating a larger quantity of melanin. Melanin acts a filter, preventing the UV rays from acting as a mutating agent in the individuals DNA. These mutations often lead to cancers, particularly melanoma, and melanoma kills approximately 8000 Americans every year. Also, prolonged exposure to UV radiation can also lead to anemia, due to folates breaking down as a result of the radiation. Folates are also necessary in the process of cellular reproduction, and the breakdown of these folates effects many cellular process, particularly the production of sperm cells.

2. Short Term Adaptations- The melanocytes produce extra melanin to filter out some of the UV rays when exposure levels are high. This results in tanning of the skin.

Facultative Adaptations- The skin will react to changes in radiation levels. If the radiation exposure is lower, for example if a person moves to an area further from the equator (like moving from Arizona to Alaska), or into an area with less direct radiation due to environmental conditions (like Seattle, WA, which averages only 58 sunny days a year) the body will not produce as much melanin. This works the opposite as well, and the body will constantly fluctuate to adapt to the radiation in it environment.

Developmental adaptation- Eventually, humans adapt to their environments UV exposure by making some of the melanin changes more permanent. In areas where radiation is higher, skin pigments tend to be darker as a result of increases in overall melanin. In areas where the UV radiation is lower, the benefits of lower melanin levels (resulting in more vitamin D production, despite less UV radiation to create it) outweigh the need for protection against the damage it causes.

Cultural Adaptations- Among the many ways humans have culturally adapted to combat UV radiation, the two most familiar are probably sunscreen and clothing. Sunscreen assists the natural melanin process by filtering out a substantial quantity of the radiation before it even touches the skin. Clothing choices, like head wraps worn by people in the Middle East protects the skin by limiting the amount of area that is exposed to the radiation in the first place.

3. By looking at the effects of solar radiation, we can come up with new ways to either fight against the negative effects of too much radiation, or we can look for ways to improve the quality of life of those who don’t get enough. Improved awareness of the more dangerous effects of UV radiation, like skin cancers, can help those whose bodies are less able to filter the radiation (such as those with light skin). For those people whose bodies may filter too much radiation boosters of Vitamin D can greatly improve the quality of life, by combating anemia and increasing their ability to utilize more calcium.
4. Human skin variation is a result of the exposure of the body to radiation over long periods of time. The darker skin tones are found closest to the equator where the solar radiation is the greatest, while lighter tones are found further from the poles, where the exposure to solar radiation is the lowest. It’s clear as you move up the latitudes (especially from sub-Saharan Africa up to Sweden), that melanin levels among indigenous peoples decreases.

  1. Congo

2. Libya

3. Italy

4. Sweden

  The question of race (particularly with regard to skin color) is not really a biological question so much as a social question. Ethnic, religious, and political differences define race more than the body’s natural response to UV exposure over hundreds of generations. Biologically, skin color is simply a body’s way of protecting itself, and not a sign of dramatic, genetic differences between the races.

the Piltdown Hoax and the Search for Fact Amongst the Rubble

    The Piltdown man was discovered in 1912 in Great Britain. It was discovered by Charles Dawson, along with Sir Arthur Smith Woodward and a priest named Pierre Teilhard de Chardin. The Piltdown man was thought to be the oldest humanoid fossil ever discovered, and based on a jawbone that featured flat teeth like those of a modern human, but was in the shape of an ape jawbone. It was heralded as not only the “missing link,” but also as the earliest Englishman. Following the find, the National History Museum in London and the Royal Geological Society fell over themselves in support of the find, and in particular, Sir Arthur Keith, a leading anatomist and anthropologist in England, felt that the fossils proved that the Piltdown man validated his theories regarding human evolution. Cranial fossils found near the jawbone seemed to prove that our ancestors evolved large brains before they became bipedal (this turned out to be false).

    However, eventually new finds were found in other places on earth that looked much younger than the Piltdown man, but were much less evolved than the fossils found by Watson. This inconsistency threw up red flags and scientists began to question the validity of the Piltdown man fossils. Following WWII, scientist performed fluorine tests which showed the samples were much younger than originally thought. They then looked at the teeth and the broken segments of the jaw, and determined that they had been manually worn down using steel knives and files. Using carbon dating, they discovered that the jawbone was actually less than 100 years old. It was discovered to have belonged to a female orangutan. This forgery ended up setting the scientific community back with years of time wasted at the sites in Piltdown and nearby Sheffield Park (where a second Piltdown man was “uncovered” by Dawson), and raised many ethical questions about the faith we have with geological finds.

   The reality is that scientists are people, and people are inherently flawed. The perpetrator of this hoax defrauded the scientific community and humanity at large. Some of the suspects include Dawson (the chief suspect), his colleagues Woodward and Teilhard de Chardin, and a man named Martin Hinton who worked at the Natural History Museum under Woodward. Woodward continued to work at the sight for decades after the death of Dawson and found nothing more to prove the existence of the Piltdown man, and because of this, it is unlikely he perpetrated the fraud. Teilhard de Chardin may have known the fossils were a hoax, but was not at the sight long enough to be a true suspect. The two most likely suspects then are Dawson and Hinton. Hinton was said to have resented Woodward and may have created the hoax to discredit him. Also, following Hinton’s death, stained and filed bones were found in a trunk in his room that were very similar in style and appearance to the Piltdown fossils. He certainly had the knowledge and skill to perpetrate the hoax as the head of the paleontology department at the Natural History Museum. However, some believe the bones were his attempt at trying to discover how the process was done so that he could expose the hoax. Dawson is the most likely suspect since he had the most to gain, and was also the one most involved in the findings (which mysteriously stopped appearing after his death). Dawson was affected by greed, pride and a desire to be important and noticed in the scientific community. These desires may have led to him deceiving the scientific community, and ultimately the world, so that he would be deemed important. While not necessarily a chief suspect, Sir Arthur Keith is also guilty of exploiting the find to further his own agenda. He pushed the idea that the Piltdown man proved his theories of human evolution, and thus made him even more powerful and distinguished in the community. The irony is that his greatest legacy is built on a lie. The last culprit is not a person, but a group. The English community (desperate to find ancient human ancestors in Britain) was blinded by nationalistic fervor. Rather than let the find explain itself through examination and study, they made it fit into their own agenda and failed to see the hoax for what it was, and were blinded by its potential to fulfill their own desires.

    If anything good came out of the Piltdown hoax, it showed that the scientific method works. One of the most important parts of the scientific method is the submission of findings for peer review and testing and retesting hypothesis. The scientists who performed the fluorine tests on the fossils performed due diligence and refused to simply accept the findings as fact. They helped to uncover that something was wrong with the find. The other scientists who put the fossils (literally) under the microscope and looked for flaws were able to find the evidence of artificial interference on the fossils and finally, the scientists who dated the bones and discovered their true age helped to end the hoax. They all performed admirably, and shed light on the failings of their predecessors, who simply took the evidence at face value.

     The only way to eliminate the human factors from science is to increase the number of scientists who can test the theories. When only one person or select group of people gets to study an artifact or fossil, then they can put their own agenda first and the “truth” second. In the case of the Piltdown man, the fossils were kept hidden away from the scientific public, and nobody could test them and check their validity. By opening up the fossils to more scrutiny, their true nature was discovered and the hoax was exposed. Human flaws will always creep into research, as we all have personal biases and agendas to promote, but by opening our work up to criticism and correction, we can whittle down the effects of those biases on the value of our work.

    In all things, be they politics, scientific discoveries, or economic proposals, one should always exercise a healthy combination of cynicism and optimism. Though, this sounds like an oxymoron (which it basically is), I mean to say that one should never take something simply at face value. We can hope that something is true, or that we have discovered something important, or that something will greatly improve our lives, but we owe it to ourselves and to the community to go in with a critical mind, and try to find weaknesses and ways to improve the concept or finding. Ultimately, the failing of the scientific community in England to truly investigate the Piltdown man and express any doubts publicly led to decades of waste and forced many to doubt the sincere efforts of the scientific community at large. If scientific theories are to be taken seriously, we must be critical and unyielding in our search for fact.

Homologous & Analogous Traits

Homologous Traits

    The woodpecker and the hummingbird are both birds, and have specially designed beaks they use to get to their food.

    Both birds use their beaks to get food, but their beaks and food sources are completely different. The hummingbird utilizes a thin, long beak that is designed to pull nectar out of even the most difficult flowers. The woodpecker, on the other hand has a strong, sharp beak designed to penetrate bark and wood in order to allow the bird to reach the insects residing within. Both birds have beaks that evolved to acquire food sources that other animals would struggle to get at, but they evolved very different beaks to achieve the same goal.

    Both birds are small, land based birds that almost certainly shared a common ancestor. As the bird moved across the world, and met new demands for food, its prodigy diverged and formed new beaks to accommodate new food sources. In semi tropical areas, where the competition for insects is higher, an adaptation that made it easier to get to nectar would give the hummingbird an advantage. In wooded areas where insects and larvae are hidden inside trees would give the woodpecker an advantage over other birds that have to wait for the insects to emerge.

Analogous Traits

    The platypus and the duck each lay eggs and have similarly shaped beaks. While they share these traits, ducks belong to the bird family, while platypodes are monotremes of the mammal family.

    In the case of ducks and platypodes, both animals have bill-style mouths designed for finding food underwater. This makes sense because both animals spend the majority of their life near the water. A bill would allow them to root through the river beds and lake beds of the areas they inhabit. Both animals also make nests and lay eggs.

    Platypodes and ducks definitely share a common ancestor, which was uncovered when the platypodes genome was mapped in 2008, and it was discovered that platypodes “[have] two matches for ZPAX genes that had previously been found only in birds, amphibians and fish.” Having two genes that correspond to bird genes would indicate a shared ancestor.** It’s a safe bet to say that the ancestor was a vertebrate, and since platypodes have eggs that are leathery like a reptile, and since reptiles can be traced back further to birds, the common ancestor was likely a prehistoric bird. It is unlikely that this bird had a bill-shaped beak, but would likely reproduce by making eggs.  

Protein Synthesis

AGTATACACCTGGGTAAGTGTTATATTGTAAATCTTGC